Review



mnk1 cell signaling  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc mnk1 cell signaling
    Mnk1 Cell Signaling, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 83 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/Mnk1+Rabbit+mAb/pmc11351721__NIHMS1946832___supplement___Supplementary_Tabless-0-50-51
    Average 93 stars, based on 83 article reviews
    mnk1 cell signaling - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title:
    Article Snippet: .. Antibody Source Cat # pS6(235) Cell Signaling 2211 S6 Cell Signaling 2217 p4E-BP1(T36/46) Cell Signaling 2855 4E-BP1 Cell Signaling 9644 ACTIN Santa Cruz 47778-HRP eIF4E(pS209) Cell Signaling 9741 eIF4E Cell Signaling 9742 MEK1 Cell Signaling #12671 p-MEK1 (Ser217) Cell Signaling #9154 ERK1-2 Cell Signaling #4695 p-ERK1-2 (Thr202) Cell Signaling #9101 MNK1 Cell Signaling #2195 MNK2 Bioss #17697R p-MNK (Thr197) Invitrogen #700242 Probe Mouse Sequence probes S6 Forward gcaaactctacctcatcctgg Reverse gctagtgtgatctctgccag 4EBP1 Forward cggaagataagcgggcag Reverse cagtgtctgcctggtatgag eIF4E Forward ttacagtccttaccacagcac Reverse gttccacagtcgccatcttag -ACTIN Forward ctaaggccaaccgtgaaaag Reverse accagaggcatacagggaca MNK2 Forward gggaggtggagatgctgta Reverse ctatggatgtggcttaggatgg MNK1 Forward tgtgactttgacttgggcag Reverse gtcatagaaagtagcctcgtcc MEK1 Forward ttcccggctgcaagatg Reverse cttctgcaaggcctccag ERK1 Forward gttataggcatccgagacatcc Reverse gtagaggaagtagcagatgtgg ERK2 Forward ggcaggtgttcgacgtag Reverse agtaggtctggtgctcaaaag ..

    Chromatin Immunoprecipitation:

    Article Title: Rescue of oxytocin response and social behaviour in a mouse model of autism.
    Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used p-eIF4E: Abcam, ab76256, EP2151Y, Lot#GR210598-1 eIF4E: Abcam, ab47482, Lot#GR100774-1 p-ERK1/2: Cell Signaling, 4370S, clone: 137F5, Lot#12 3 nature research | reporting sum m ary O ctober 2018 ERK1/2: Cell Signaling, 4695S, clone: D13.14.4E, Lot#14 p-eIF4G: Cell Signaling, 2441S, Lot#4 eIF4G: Cell Signaling, 2498, Lot#4 p-MNK1: Cell Signaling, 2111, Lot#6 MNK1: Cell Signaling, 2195S, Lot#5 GAPDH: Cell Signaling, 5174, clone: D16H11, Lot#7 calnexin: Stressgen, SPA-865, Lot#01031711 puromycin: Kerafast, EQ0001, clone: 3RH11, Lot#2733311 TH: Millipor, AB1542, Lot#2982635 neurophysin-1: Millipor, MABN844, clone: PS38, Lot#3083532 donkey anti-sheep IgG-Cy3 Jackson ImmunoResearch 713-165-147 donkey anti-sheep Cy5 Jackson ImmunoResearch 713-175-147 donkey anti-rabbit IgG Cy3 Jackson ImmunoResearch 711-165-152 goat anti-mouse Cy2 Jackson ImmunoResearch 714-225-150 Validation p-eIF4E: WB: validated using positive control 293 cell lysate treated with alkaline phosphatase and HEK293 cell lysate treated with Dexamethasone (abcam.com). eIF4E: evaluated by western blotting using Breast carcinoma tissue and NIH/3T3 cells extract (abcam.com) p-ERK1/2: evaluated by western blotting using extracts from COS cells, untreated or treated with either U0126 #9903 (10 μM for 1h) or TPA (cellsignal.com) ERK1/2: evaluated by western blotting using extracts from HeLa, NIH/3T3 and C6 cells (cellsignal.com) p-eIF4G: evaluated by western blotting using extracts from 293 cells expressing GST-eIF4GI Ser1192Ala or GST-eIF4GI Ser1108Ala mutant protein (cellsignal.com) eIF4G: evaluated by western blotting using extracts from various cell lines (cellsignal.com) p-MNK1: evaluated by western blotting in NIH/3T3 cells serum starved for 24h and then treated or untreated with serum for 30 min (cellsignal.com) MNK1: evaluated by western blot analysis of extracts from various cell lines (cellsignal.com) GAPDH: evaluated by western blotting using extracts from various cell lines (cellsignal.com) calnexin: evaluated by western blotting using MWM, Vero, 3T3, PC-12, and HeLa cell lines (enzolifesciences.com) puromycin: evaluated for western blotting (Kelleher, AR., et al. (2013). ..

    Flow Cytometry:

    Article Title: Rescue of oxytocin response and social behaviour in a mouse model of autism.
    Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used p-eIF4E: Abcam, ab76256, EP2151Y, Lot#GR210598-1 eIF4E: Abcam, ab47482, Lot#GR100774-1 p-ERK1/2: Cell Signaling, 4370S, clone: 137F5, Lot#12 3 nature research | reporting sum m ary O ctober 2018 ERK1/2: Cell Signaling, 4695S, clone: D13.14.4E, Lot#14 p-eIF4G: Cell Signaling, 2441S, Lot#4 eIF4G: Cell Signaling, 2498, Lot#4 p-MNK1: Cell Signaling, 2111, Lot#6 MNK1: Cell Signaling, 2195S, Lot#5 GAPDH: Cell Signaling, 5174, clone: D16H11, Lot#7 calnexin: Stressgen, SPA-865, Lot#01031711 puromycin: Kerafast, EQ0001, clone: 3RH11, Lot#2733311 TH: Millipor, AB1542, Lot#2982635 neurophysin-1: Millipor, MABN844, clone: PS38, Lot#3083532 donkey anti-sheep IgG-Cy3 Jackson ImmunoResearch 713-165-147 donkey anti-sheep Cy5 Jackson ImmunoResearch 713-175-147 donkey anti-rabbit IgG Cy3 Jackson ImmunoResearch 711-165-152 goat anti-mouse Cy2 Jackson ImmunoResearch 714-225-150 Validation p-eIF4E: WB: validated using positive control 293 cell lysate treated with alkaline phosphatase and HEK293 cell lysate treated with Dexamethasone (abcam.com). eIF4E: evaluated by western blotting using Breast carcinoma tissue and NIH/3T3 cells extract (abcam.com) p-ERK1/2: evaluated by western blotting using extracts from COS cells, untreated or treated with either U0126 #9903 (10 μM for 1h) or TPA (cellsignal.com) ERK1/2: evaluated by western blotting using extracts from HeLa, NIH/3T3 and C6 cells (cellsignal.com) p-eIF4G: evaluated by western blotting using extracts from 293 cells expressing GST-eIF4GI Ser1192Ala or GST-eIF4GI Ser1108Ala mutant protein (cellsignal.com) eIF4G: evaluated by western blotting using extracts from various cell lines (cellsignal.com) p-MNK1: evaluated by western blotting in NIH/3T3 cells serum starved for 24h and then treated or untreated with serum for 30 min (cellsignal.com) MNK1: evaluated by western blot analysis of extracts from various cell lines (cellsignal.com) GAPDH: evaluated by western blotting using extracts from various cell lines (cellsignal.com) calnexin: evaluated by western blotting using MWM, Vero, 3T3, PC-12, and HeLa cell lines (enzolifesciences.com) puromycin: evaluated for western blotting (Kelleher, AR., et al. (2013). ..

    Magnetic Resonance Imaging:

    Article Title: Rescue of oxytocin response and social behaviour in a mouse model of autism.
    Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used p-eIF4E: Abcam, ab76256, EP2151Y, Lot#GR210598-1 eIF4E: Abcam, ab47482, Lot#GR100774-1 p-ERK1/2: Cell Signaling, 4370S, clone: 137F5, Lot#12 3 nature research | reporting sum m ary O ctober 2018 ERK1/2: Cell Signaling, 4695S, clone: D13.14.4E, Lot#14 p-eIF4G: Cell Signaling, 2441S, Lot#4 eIF4G: Cell Signaling, 2498, Lot#4 p-MNK1: Cell Signaling, 2111, Lot#6 MNK1: Cell Signaling, 2195S, Lot#5 GAPDH: Cell Signaling, 5174, clone: D16H11, Lot#7 calnexin: Stressgen, SPA-865, Lot#01031711 puromycin: Kerafast, EQ0001, clone: 3RH11, Lot#2733311 TH: Millipor, AB1542, Lot#2982635 neurophysin-1: Millipor, MABN844, clone: PS38, Lot#3083532 donkey anti-sheep IgG-Cy3 Jackson ImmunoResearch 713-165-147 donkey anti-sheep Cy5 Jackson ImmunoResearch 713-175-147 donkey anti-rabbit IgG Cy3 Jackson ImmunoResearch 711-165-152 goat anti-mouse Cy2 Jackson ImmunoResearch 714-225-150 Validation p-eIF4E: WB: validated using positive control 293 cell lysate treated with alkaline phosphatase and HEK293 cell lysate treated with Dexamethasone (abcam.com). eIF4E: evaluated by western blotting using Breast carcinoma tissue and NIH/3T3 cells extract (abcam.com) p-ERK1/2: evaluated by western blotting using extracts from COS cells, untreated or treated with either U0126 #9903 (10 μM for 1h) or TPA (cellsignal.com) ERK1/2: evaluated by western blotting using extracts from HeLa, NIH/3T3 and C6 cells (cellsignal.com) p-eIF4G: evaluated by western blotting using extracts from 293 cells expressing GST-eIF4GI Ser1192Ala or GST-eIF4GI Ser1108Ala mutant protein (cellsignal.com) eIF4G: evaluated by western blotting using extracts from various cell lines (cellsignal.com) p-MNK1: evaluated by western blotting in NIH/3T3 cells serum starved for 24h and then treated or untreated with serum for 30 min (cellsignal.com) MNK1: evaluated by western blot analysis of extracts from various cell lines (cellsignal.com) GAPDH: evaluated by western blotting using extracts from various cell lines (cellsignal.com) calnexin: evaluated by western blotting using MWM, Vero, 3T3, PC-12, and HeLa cell lines (enzolifesciences.com) puromycin: evaluated for western blotting (Kelleher, AR., et al. (2013). ..

    Biomarker Discovery:

    Article Title: Rescue of oxytocin response and social behaviour in a mouse model of autism.
    Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used p-eIF4E: Abcam, ab76256, EP2151Y, Lot#GR210598-1 eIF4E: Abcam, ab47482, Lot#GR100774-1 p-ERK1/2: Cell Signaling, 4370S, clone: 137F5, Lot#12 3 nature research | reporting sum m ary O ctober 2018 ERK1/2: Cell Signaling, 4695S, clone: D13.14.4E, Lot#14 p-eIF4G: Cell Signaling, 2441S, Lot#4 eIF4G: Cell Signaling, 2498, Lot#4 p-MNK1: Cell Signaling, 2111, Lot#6 MNK1: Cell Signaling, 2195S, Lot#5 GAPDH: Cell Signaling, 5174, clone: D16H11, Lot#7 calnexin: Stressgen, SPA-865, Lot#01031711 puromycin: Kerafast, EQ0001, clone: 3RH11, Lot#2733311 TH: Millipor, AB1542, Lot#2982635 neurophysin-1: Millipor, MABN844, clone: PS38, Lot#3083532 donkey anti-sheep IgG-Cy3 Jackson ImmunoResearch 713-165-147 donkey anti-sheep Cy5 Jackson ImmunoResearch 713-175-147 donkey anti-rabbit IgG Cy3 Jackson ImmunoResearch 711-165-152 goat anti-mouse Cy2 Jackson ImmunoResearch 714-225-150 Validation p-eIF4E: WB: validated using positive control 293 cell lysate treated with alkaline phosphatase and HEK293 cell lysate treated with Dexamethasone (abcam.com). eIF4E: evaluated by western blotting using Breast carcinoma tissue and NIH/3T3 cells extract (abcam.com) p-ERK1/2: evaluated by western blotting using extracts from COS cells, untreated or treated with either U0126 #9903 (10 μM for 1h) or TPA (cellsignal.com) ERK1/2: evaluated by western blotting using extracts from HeLa, NIH/3T3 and C6 cells (cellsignal.com) p-eIF4G: evaluated by western blotting using extracts from 293 cells expressing GST-eIF4GI Ser1192Ala or GST-eIF4GI Ser1108Ala mutant protein (cellsignal.com) eIF4G: evaluated by western blotting using extracts from various cell lines (cellsignal.com) p-MNK1: evaluated by western blotting in NIH/3T3 cells serum starved for 24h and then treated or untreated with serum for 30 min (cellsignal.com) MNK1: evaluated by western blot analysis of extracts from various cell lines (cellsignal.com) GAPDH: evaluated by western blotting using extracts from various cell lines (cellsignal.com) calnexin: evaluated by western blotting using MWM, Vero, 3T3, PC-12, and HeLa cell lines (enzolifesciences.com) puromycin: evaluated for western blotting (Kelleher, AR., et al. (2013). ..

    Western Blot:

    Article Title: Rescue of oxytocin response and social behaviour in a mouse model of autism.
    Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used p-eIF4E: Abcam, ab76256, EP2151Y, Lot#GR210598-1 eIF4E: Abcam, ab47482, Lot#GR100774-1 p-ERK1/2: Cell Signaling, 4370S, clone: 137F5, Lot#12 3 nature research | reporting sum m ary O ctober 2018 ERK1/2: Cell Signaling, 4695S, clone: D13.14.4E, Lot#14 p-eIF4G: Cell Signaling, 2441S, Lot#4 eIF4G: Cell Signaling, 2498, Lot#4 p-MNK1: Cell Signaling, 2111, Lot#6 MNK1: Cell Signaling, 2195S, Lot#5 GAPDH: Cell Signaling, 5174, clone: D16H11, Lot#7 calnexin: Stressgen, SPA-865, Lot#01031711 puromycin: Kerafast, EQ0001, clone: 3RH11, Lot#2733311 TH: Millipor, AB1542, Lot#2982635 neurophysin-1: Millipor, MABN844, clone: PS38, Lot#3083532 donkey anti-sheep IgG-Cy3 Jackson ImmunoResearch 713-165-147 donkey anti-sheep Cy5 Jackson ImmunoResearch 713-175-147 donkey anti-rabbit IgG Cy3 Jackson ImmunoResearch 711-165-152 goat anti-mouse Cy2 Jackson ImmunoResearch 714-225-150 Validation p-eIF4E: WB: validated using positive control 293 cell lysate treated with alkaline phosphatase and HEK293 cell lysate treated with Dexamethasone (abcam.com). eIF4E: evaluated by western blotting using Breast carcinoma tissue and NIH/3T3 cells extract (abcam.com) p-ERK1/2: evaluated by western blotting using extracts from COS cells, untreated or treated with either U0126 #9903 (10 μM for 1h) or TPA (cellsignal.com) ERK1/2: evaluated by western blotting using extracts from HeLa, NIH/3T3 and C6 cells (cellsignal.com) p-eIF4G: evaluated by western blotting using extracts from 293 cells expressing GST-eIF4GI Ser1192Ala or GST-eIF4GI Ser1108Ala mutant protein (cellsignal.com) eIF4G: evaluated by western blotting using extracts from various cell lines (cellsignal.com) p-MNK1: evaluated by western blotting in NIH/3T3 cells serum starved for 24h and then treated or untreated with serum for 30 min (cellsignal.com) MNK1: evaluated by western blot analysis of extracts from various cell lines (cellsignal.com) GAPDH: evaluated by western blotting using extracts from various cell lines (cellsignal.com) calnexin: evaluated by western blotting using MWM, Vero, 3T3, PC-12, and HeLa cell lines (enzolifesciences.com) puromycin: evaluated for western blotting (Kelleher, AR., et al. (2013). ..

    Positive Control:

    Article Title: Rescue of oxytocin response and social behaviour in a mouse model of autism.
    Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used p-eIF4E: Abcam, ab76256, EP2151Y, Lot#GR210598-1 eIF4E: Abcam, ab47482, Lot#GR100774-1 p-ERK1/2: Cell Signaling, 4370S, clone: 137F5, Lot#12 3 nature research | reporting sum m ary O ctober 2018 ERK1/2: Cell Signaling, 4695S, clone: D13.14.4E, Lot#14 p-eIF4G: Cell Signaling, 2441S, Lot#4 eIF4G: Cell Signaling, 2498, Lot#4 p-MNK1: Cell Signaling, 2111, Lot#6 MNK1: Cell Signaling, 2195S, Lot#5 GAPDH: Cell Signaling, 5174, clone: D16H11, Lot#7 calnexin: Stressgen, SPA-865, Lot#01031711 puromycin: Kerafast, EQ0001, clone: 3RH11, Lot#2733311 TH: Millipor, AB1542, Lot#2982635 neurophysin-1: Millipor, MABN844, clone: PS38, Lot#3083532 donkey anti-sheep IgG-Cy3 Jackson ImmunoResearch 713-165-147 donkey anti-sheep Cy5 Jackson ImmunoResearch 713-175-147 donkey anti-rabbit IgG Cy3 Jackson ImmunoResearch 711-165-152 goat anti-mouse Cy2 Jackson ImmunoResearch 714-225-150 Validation p-eIF4E: WB: validated using positive control 293 cell lysate treated with alkaline phosphatase and HEK293 cell lysate treated with Dexamethasone (abcam.com). eIF4E: evaluated by western blotting using Breast carcinoma tissue and NIH/3T3 cells extract (abcam.com) p-ERK1/2: evaluated by western blotting using extracts from COS cells, untreated or treated with either U0126 #9903 (10 μM for 1h) or TPA (cellsignal.com) ERK1/2: evaluated by western blotting using extracts from HeLa, NIH/3T3 and C6 cells (cellsignal.com) p-eIF4G: evaluated by western blotting using extracts from 293 cells expressing GST-eIF4GI Ser1192Ala or GST-eIF4GI Ser1108Ala mutant protein (cellsignal.com) eIF4G: evaluated by western blotting using extracts from various cell lines (cellsignal.com) p-MNK1: evaluated by western blotting in NIH/3T3 cells serum starved for 24h and then treated or untreated with serum for 30 min (cellsignal.com) MNK1: evaluated by western blot analysis of extracts from various cell lines (cellsignal.com) GAPDH: evaluated by western blotting using extracts from various cell lines (cellsignal.com) calnexin: evaluated by western blotting using MWM, Vero, 3T3, PC-12, and HeLa cell lines (enzolifesciences.com) puromycin: evaluated for western blotting (Kelleher, AR., et al. (2013). ..

    Expressing:

    Article Title: Rescue of oxytocin response and social behaviour in a mouse model of autism.
    Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used p-eIF4E: Abcam, ab76256, EP2151Y, Lot#GR210598-1 eIF4E: Abcam, ab47482, Lot#GR100774-1 p-ERK1/2: Cell Signaling, 4370S, clone: 137F5, Lot#12 3 nature research | reporting sum m ary O ctober 2018 ERK1/2: Cell Signaling, 4695S, clone: D13.14.4E, Lot#14 p-eIF4G: Cell Signaling, 2441S, Lot#4 eIF4G: Cell Signaling, 2498, Lot#4 p-MNK1: Cell Signaling, 2111, Lot#6 MNK1: Cell Signaling, 2195S, Lot#5 GAPDH: Cell Signaling, 5174, clone: D16H11, Lot#7 calnexin: Stressgen, SPA-865, Lot#01031711 puromycin: Kerafast, EQ0001, clone: 3RH11, Lot#2733311 TH: Millipor, AB1542, Lot#2982635 neurophysin-1: Millipor, MABN844, clone: PS38, Lot#3083532 donkey anti-sheep IgG-Cy3 Jackson ImmunoResearch 713-165-147 donkey anti-sheep Cy5 Jackson ImmunoResearch 713-175-147 donkey anti-rabbit IgG Cy3 Jackson ImmunoResearch 711-165-152 goat anti-mouse Cy2 Jackson ImmunoResearch 714-225-150 Validation p-eIF4E: WB: validated using positive control 293 cell lysate treated with alkaline phosphatase and HEK293 cell lysate treated with Dexamethasone (abcam.com). eIF4E: evaluated by western blotting using Breast carcinoma tissue and NIH/3T3 cells extract (abcam.com) p-ERK1/2: evaluated by western blotting using extracts from COS cells, untreated or treated with either U0126 #9903 (10 μM for 1h) or TPA (cellsignal.com) ERK1/2: evaluated by western blotting using extracts from HeLa, NIH/3T3 and C6 cells (cellsignal.com) p-eIF4G: evaluated by western blotting using extracts from 293 cells expressing GST-eIF4GI Ser1192Ala or GST-eIF4GI Ser1108Ala mutant protein (cellsignal.com) eIF4G: evaluated by western blotting using extracts from various cell lines (cellsignal.com) p-MNK1: evaluated by western blotting in NIH/3T3 cells serum starved for 24h and then treated or untreated with serum for 30 min (cellsignal.com) MNK1: evaluated by western blot analysis of extracts from various cell lines (cellsignal.com) GAPDH: evaluated by western blotting using extracts from various cell lines (cellsignal.com) calnexin: evaluated by western blotting using MWM, Vero, 3T3, PC-12, and HeLa cell lines (enzolifesciences.com) puromycin: evaluated for western blotting (Kelleher, AR., et al. (2013). ..

    Mutagenesis:

    Article Title: Rescue of oxytocin response and social behaviour in a mouse model of autism.
    Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used p-eIF4E: Abcam, ab76256, EP2151Y, Lot#GR210598-1 eIF4E: Abcam, ab47482, Lot#GR100774-1 p-ERK1/2: Cell Signaling, 4370S, clone: 137F5, Lot#12 3 nature research | reporting sum m ary O ctober 2018 ERK1/2: Cell Signaling, 4695S, clone: D13.14.4E, Lot#14 p-eIF4G: Cell Signaling, 2441S, Lot#4 eIF4G: Cell Signaling, 2498, Lot#4 p-MNK1: Cell Signaling, 2111, Lot#6 MNK1: Cell Signaling, 2195S, Lot#5 GAPDH: Cell Signaling, 5174, clone: D16H11, Lot#7 calnexin: Stressgen, SPA-865, Lot#01031711 puromycin: Kerafast, EQ0001, clone: 3RH11, Lot#2733311 TH: Millipor, AB1542, Lot#2982635 neurophysin-1: Millipor, MABN844, clone: PS38, Lot#3083532 donkey anti-sheep IgG-Cy3 Jackson ImmunoResearch 713-165-147 donkey anti-sheep Cy5 Jackson ImmunoResearch 713-175-147 donkey anti-rabbit IgG Cy3 Jackson ImmunoResearch 711-165-152 goat anti-mouse Cy2 Jackson ImmunoResearch 714-225-150 Validation p-eIF4E: WB: validated using positive control 293 cell lysate treated with alkaline phosphatase and HEK293 cell lysate treated with Dexamethasone (abcam.com). eIF4E: evaluated by western blotting using Breast carcinoma tissue and NIH/3T3 cells extract (abcam.com) p-ERK1/2: evaluated by western blotting using extracts from COS cells, untreated or treated with either U0126 #9903 (10 μM for 1h) or TPA (cellsignal.com) ERK1/2: evaluated by western blotting using extracts from HeLa, NIH/3T3 and C6 cells (cellsignal.com) p-eIF4G: evaluated by western blotting using extracts from 293 cells expressing GST-eIF4GI Ser1192Ala or GST-eIF4GI Ser1108Ala mutant protein (cellsignal.com) eIF4G: evaluated by western blotting using extracts from various cell lines (cellsignal.com) p-MNK1: evaluated by western blotting in NIH/3T3 cells serum starved for 24h and then treated or untreated with serum for 30 min (cellsignal.com) MNK1: evaluated by western blot analysis of extracts from various cell lines (cellsignal.com) GAPDH: evaluated by western blotting using extracts from various cell lines (cellsignal.com) calnexin: evaluated by western blotting using MWM, Vero, 3T3, PC-12, and HeLa cell lines (enzolifesciences.com) puromycin: evaluated for western blotting (Kelleher, AR., et al. (2013). ..



    Similar Products

    mnk1 cell signaling  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc mnk1 cell signaling
    Mnk1 Cell Signaling, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/Mnk1+Rabbit+mAb/pmc11351721__NIHMS1946832___supplement___Supplementary_Tabless-0-50-51
    Average 93 stars, based on 1 article reviews
    mnk1 cell signaling - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    ihc cell signaling 2195 c4c1 eif4e human  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc ihc cell signaling 2195 c4c1 eif4e human
    Ihc Cell Signaling 2195 C4c1 Eif4e Human, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/Mnk1+Rabbit+mAb/pmc11397505__sciadv__adi7673_sm-89-10-11
    Average 93 stars, based on 1 article reviews
    ihc cell signaling 2195 c4c1 eif4e human - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mnk1 c4c1 cell signaling mnk1  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc mnk1 c4c1 cell signaling mnk1
    Mnk1 C4c1 Cell Signaling Mnk1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/Mnk1+Rabbit+mAb/pmc09705393__mmc1-4-52-53
    Average 93 stars, based on 1 article reviews
    mnk1 c4c1 cell signaling mnk1 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    3398 mknk1 mnk1 cell signaling technology 2195 phospho eif4e  (Cell Signaling Technology Inc)
    98
    Cell Signaling Technology Inc 3398 mknk1 mnk1 cell signaling technology 2195 phospho eif4e
    3398 Mknk1 Mnk1 Cell Signaling Technology 2195 Phospho Eif4e, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/LC3A%2FB+XP+Rabbit+mAb/pmc09588786__41467_2022_34096_MOESM1_ESM-25-35-37
    Average 98 stars, based on 1 article reviews
    3398 mknk1 mnk1 cell signaling technology 2195 phospho eif4e - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    r cst 3180 cell signaling technology mnk1  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc r cst 3180 cell signaling technology mnk1
    R Cst 3180 Cell Signaling Technology Mnk1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/Fatty+Acid+Synthase+Rabbit+mAb/10__1042_slash_bcj20200433-98-208-209
    Average 96 stars, based on 1 article reviews
    r cst 3180 cell signaling technology mnk1 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    r cst 2195 cell signaling technology 2020  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc r cst 2195 cell signaling technology 2020
    R Cst 2195 Cell Signaling Technology 2020, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/Mnk1+Rabbit+mAb/10__1042_slash_bcj20200433-98-217-218
    Average 93 stars, based on 1 article reviews
    r cst 2195 cell signaling technology 2020 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mknk1 rab cell signaling 2195s ab  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc mknk1 rab cell signaling 2195s ab
    Figure 4. Some translational factors are relatively enriched in the XY body of pachytene spermatocytes. (A-D) EIF4F complex members EIF4A1, EIF4E, EIF4E2, and phosphorylated EIF4E were found in the XY body. (E-H) Small ribosomal subunit protein RPS6 and large ribosomal subunit protein RPL10L, and RNA-binding proteins MSI1 and TSN were relatively enriched in the XY body. (I-L) Translational activators <t>MKNK1</t> and MKNK2, and repressors EIF4EBP1 and EIF2C4 (AGO4), were found in the XY body. Bars = 5 μm.
    Mknk1 Rab Cell Signaling 2195s Ab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/Mnk1+Rabbit+mAb/pm29161344-106-78-80
    Average 93 stars, based on 1 article reviews
    mknk1 rab cell signaling 2195s ab - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mknk1 rab cell signaling 2195s ab 2235175  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc mknk1 rab cell signaling 2195s ab 2235175
    Primary antibodies used in this study.
    Mknk1 Rab Cell Signaling 2195s Ab 2235175, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mnk1+cell+signaling/Mnk1+Rabbit+mAb/pmc05819848-125-69-71
    Average 93 stars, based on 1 article reviews
    mknk1 rab cell signaling 2195s ab 2235175 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Figure 4. Some translational factors are relatively enriched in the XY body of pachytene spermatocytes. (A-D) EIF4F complex members EIF4A1, EIF4E, EIF4E2, and phosphorylated EIF4E were found in the XY body. (E-H) Small ribosomal subunit protein RPS6 and large ribosomal subunit protein RPL10L, and RNA-binding proteins MSI1 and TSN were relatively enriched in the XY body. (I-L) Translational activators MKNK1 and MKNK2, and repressors EIF4EBP1 and EIF2C4 (AGO4), were found in the XY body. Bars = 5 μm.

    Journal: Biology of reproduction

    Article Title: Nuclear localization of EIF4G3 suggests a role for the XY body in translational regulation during spermatogenesis in mice.

    doi: 10.1093/biolre/iox150

    Figure Lengend Snippet: Figure 4. Some translational factors are relatively enriched in the XY body of pachytene spermatocytes. (A-D) EIF4F complex members EIF4A1, EIF4E, EIF4E2, and phosphorylated EIF4E were found in the XY body. (E-H) Small ribosomal subunit protein RPS6 and large ribosomal subunit protein RPL10L, and RNA-binding proteins MSI1 and TSN were relatively enriched in the XY body. (I-L) Translational activators MKNK1 and MKNK2, and repressors EIF4EBP1 and EIF2C4 (AGO4), were found in the XY body. Bars = 5 μm.

    Article Snippet: 1:500 n/a POLR2A Mo Abcam Ab32485 AB 732124 1:100 n/a RPS3 Rab Thermo PA5-27974 AB 2545450 1:100 n/a RPS6 Mo Thermo MA5-15123 AB 10999800 1:100 n/a RPS13 Rab Abcam Ab104862 AB 10712319 1:100 n/a RPL10A Mo Santa Cruz sc-100827 AB 2285311 1:100 n/a RPL10L Mo Abnova 115–214 AB 10864171 1:50 n/a RPL28 Go Santa Cruz sc-14151 AB 2181749 1:100 n/a EIF4EBP1 Go Santa Cruz sc-6025 AB 633426 1:100 n/a AGO4 Go Santa Cruz sc-32664 AB 2277670 1:100 n/a MKNK1 Rab Cell Signaling 2195S AB 2235175 1:100 n/a MKNK2 Rab Abcam Ab84345 AB 1860814 1:100 n/a PABPC1 Rab Abcam Ab21060 AB 777008 1:100 1:1000 BOLL Rab Thermo PA5-30808 AB 2548282 1:150 n/a DAZL Rab Cell signaling 8042S AB 10860078 1:150 1:2000 ELAVL1 Rab Millipore 07-468 AB 310641 1:200 1:2000 MSI1 Go R&D AF2628 AB 2147926 1:50 n/a TSN Rab Abcam Ab71775 AB 1524509 1:50 n/a HSPA2 Rab ProteinTech 12797-1-AP AB 2119687 1:500 n/a pCDK1 Rab Thermo MA5-15062 AB 10984869 1:50 n/a pCDK2 Rab Cell signaling 2561S AB 2078685 1:100 n/a pCHEK1 Rab Cell signaling 2341S AB 330023 1:100 n/a pCHEK2 Rab Abcam Ab59408 AB 942224 1:100 n/a p4EBP1(S64) Rab Cell Signaling 9451S AB 330947 1:100 n/a p4EBP1(T69) Rab Cell Signaling 9455S AB 330949 1:50 n/a p4EBP1(S111) Rab Abgent AP3473a AB 1278020 1:50 n/a Puromycin Mo Millipore MABE343 AB 2566826 1:10 000 n/a TUBA1A Mo Sigma T9026 AB 477593 1:500 1:5000 TUBG1 Go Santa Cruz sc-7396 AB 2211262 1:200 n/a FLAG Mo Sigma F1804 AB 262044 1:200 n/a method (Pierce Biotechnology).

    Techniques: RNA Binding Assay

    Primary antibodies used in this study.

    Journal: Biology of Reproduction

    Article Title: Nuclear localization of EIF4G3 suggests a role for the XY body in translational regulation during spermatogenesis in mice †

    doi: 10.1093/biolre/iox150

    Figure Lengend Snippet: Primary antibodies used in this study.

    Article Snippet: 1:500 n/a POLR2A Mo Abcam Ab32485 AB_732124 1:100 n/a RPS3 Rab Thermo PA5-27974 AB_2545450 1:100 n/a RPS6 Mo Thermo MA5-15123 AB_10999800 1:100 n/a RPS13 Rab Abcam Ab104862 AB_10712319 1:100 n/a RPL10A Mo Santa Cruz sc-100827 AB_2285311 1:100 n/a RPL10L Mo Abnova 115–214 AB_10864171 1:50 n/a RPL28 Go Santa Cruz sc-14151 AB_2181749 1:100 n/a EIF4EBP1 Go Santa Cruz sc-6025 AB_633426 1:100 n/a AGO4 Go Santa Cruz sc-32664 AB_2277670 1:100 n/a MKNK1 Rab Cell Signaling 2195S AB_2235175 1:100 n/a MKNK2 Rab Abcam Ab84345 AB_1860814 1:100 n/a PABPC1 Rab Abcam Ab21060 AB_777008 1:100 1:1000 BOLL Rab Thermo PA5-30808 AB_2548282 1:150 n/a DAZL Rab Cell signaling 8042S AB_10860078 1:150 1:2000 ELAVL1 Rab Millipore 07-468 AB_310641 1:200 1:2000 MSI1 Go R&D AF2628 AB_2147926 1:50 n/a TSN Rab Abcam Ab71775 AB_1524509 1:50 n/a HSPA2 Rab ProteinTech 12797-1-AP AB_2119687 1:500 n/a pCDK1 Rab Thermo MA5-15062 AB_10984869 1:50 n/a pCDK2 Rab Cell signaling 2561S AB_2078685 1:100 n/a pCHEK1 Rab Cell signaling 2341S AB_330023 1:100 n/a pCHEK2 Rab Abcam Ab59408 AB_942224 1:100 n/a p4EBP1(S64) Rab Cell Signaling 9451S AB_330947 1:100 n/a p4EBP1(T69) Rab Cell Signaling 9455S AB_330949 1:50 n/a p4EBP1(S111) Rab Abgent AP3473a AB_1278020 1:50 n/a Puromycin Mo Millipore MABE343 AB_2566826 1:10 000 n/a TUBA1A Mo Sigma T9026 AB_477593 1:500 1:5000 TUBG1 Go Santa Cruz sc-7396 AB_2211262 1:200 n/a FLAG Mo Sigma F1804 AB_262044 1:200 n/a Open in a separate window Primary antibodies used in this study.

    Techniques:

    Some translational factors are relatively enriched in the XY body of pachytene spermatocytes. (A-D) EIF4F complex members EIF4A1, EIF4E, EIF4E2, and phosphorylated EIF4E were found in the XY body. (E-H) Small ribosomal subunit protein RPS6 and large ribosomal subunit protein RPL10L, and RNA-binding proteins MSI1 and TSN were relatively enriched in the XY body. (I-L) Translational activators MKNK1 and MKNK2, and repressors EIF4EBP1 and EIF2C4 (AGO4), were found in the XY body. Bars = 5 μm.

    Journal: Biology of Reproduction

    Article Title: Nuclear localization of EIF4G3 suggests a role for the XY body in translational regulation during spermatogenesis in mice †

    doi: 10.1093/biolre/iox150

    Figure Lengend Snippet: Some translational factors are relatively enriched in the XY body of pachytene spermatocytes. (A-D) EIF4F complex members EIF4A1, EIF4E, EIF4E2, and phosphorylated EIF4E were found in the XY body. (E-H) Small ribosomal subunit protein RPS6 and large ribosomal subunit protein RPL10L, and RNA-binding proteins MSI1 and TSN were relatively enriched in the XY body. (I-L) Translational activators MKNK1 and MKNK2, and repressors EIF4EBP1 and EIF2C4 (AGO4), were found in the XY body. Bars = 5 μm.

    Article Snippet: 1:500 n/a POLR2A Mo Abcam Ab32485 AB_732124 1:100 n/a RPS3 Rab Thermo PA5-27974 AB_2545450 1:100 n/a RPS6 Mo Thermo MA5-15123 AB_10999800 1:100 n/a RPS13 Rab Abcam Ab104862 AB_10712319 1:100 n/a RPL10A Mo Santa Cruz sc-100827 AB_2285311 1:100 n/a RPL10L Mo Abnova 115–214 AB_10864171 1:50 n/a RPL28 Go Santa Cruz sc-14151 AB_2181749 1:100 n/a EIF4EBP1 Go Santa Cruz sc-6025 AB_633426 1:100 n/a AGO4 Go Santa Cruz sc-32664 AB_2277670 1:100 n/a MKNK1 Rab Cell Signaling 2195S AB_2235175 1:100 n/a MKNK2 Rab Abcam Ab84345 AB_1860814 1:100 n/a PABPC1 Rab Abcam Ab21060 AB_777008 1:100 1:1000 BOLL Rab Thermo PA5-30808 AB_2548282 1:150 n/a DAZL Rab Cell signaling 8042S AB_10860078 1:150 1:2000 ELAVL1 Rab Millipore 07-468 AB_310641 1:200 1:2000 MSI1 Go R&D AF2628 AB_2147926 1:50 n/a TSN Rab Abcam Ab71775 AB_1524509 1:50 n/a HSPA2 Rab ProteinTech 12797-1-AP AB_2119687 1:500 n/a pCDK1 Rab Thermo MA5-15062 AB_10984869 1:50 n/a pCDK2 Rab Cell signaling 2561S AB_2078685 1:100 n/a pCHEK1 Rab Cell signaling 2341S AB_330023 1:100 n/a pCHEK2 Rab Abcam Ab59408 AB_942224 1:100 n/a p4EBP1(S64) Rab Cell Signaling 9451S AB_330947 1:100 n/a p4EBP1(T69) Rab Cell Signaling 9455S AB_330949 1:50 n/a p4EBP1(S111) Rab Abgent AP3473a AB_1278020 1:50 n/a Puromycin Mo Millipore MABE343 AB_2566826 1:10 000 n/a TUBA1A Mo Sigma T9026 AB_477593 1:500 1:5000 TUBG1 Go Santa Cruz sc-7396 AB_2211262 1:200 n/a FLAG Mo Sigma F1804 AB_262044 1:200 n/a Open in a separate window Primary antibodies used in this study.

    Techniques: RNA Binding Assay